Review



2016 n a experimental models  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    ATCC 2016 n a experimental models
    KEY RESOURCES TABLE
    2016 N A Experimental Models, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 980 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2016+n+a+experimental+models/pmc05687886-661-25-14?v=ATCC
    Average 96 stars, based on 980 article reviews
    2016 n a experimental models - by Bioz Stars, 2026-08
    96/100 stars

    Images

    1) Product Images from "ESRP1 mutations cause hearing loss due to defects in alternative splicing that disrupt cochlear development"

    Article Title: ESRP1 mutations cause hearing loss due to defects in alternative splicing that disrupt cochlear development

    Journal: Developmental cell

    doi: 10.1016/j.devcel.2017.09.026


    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Transduction, Recombinant, Isolation, Derivative Assay, Modification, Sequencing, CRISPR, Software



    Similar Products

    2016 n a experimental models  (ATCC)
    96
    ATCC 2016 n a experimental models
    KEY RESOURCES TABLE
    2016 N A Experimental Models, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2016+n+a+experimental+models/pmc05687886-661-25-14?v=ATCC
    Average 96 stars, based on 1 article reviews
    2016 n a experimental models - by Bioz Stars, 2026-08
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: Developmental cell

    Article Title: ESRP1 mutations cause hearing loss due to defects in alternative splicing that disrupt cochlear development

    doi: 10.1016/j.devcel.2017.09.026

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Experimental Models: Cell Lines Human: patient derived IPSCs This paper N/A Human: MDA-MB-231 cells ATCC HTB-26 Mouse: Esrp1 −/− embryonic stem cells Cieply et al. 2016 N/A Experimental Models: Organisms/Strains Mouse: Esrp1 +/− Bebee et al. 2015 N/A Mouse: Fgf9 +/− - B6N(Cg)-Fgf9 tm1b(KOMP)Wtsi/J The Jackson Laboratories 0224362 Recombinant DNA PMX-CFF-B Modified from Toshio Kitamura N/A Sequence-Based Reagents PCR Primers for human ESRP1 and ESRP2 exons see Table S3 This paper N/A Primers used to detect gene specific alternative splicing switches by RT-PCR.see Table S4 This paper N/A sgRNA oligos for ESRP1 (c.665_683 del) CRISPR: F: caccGATGGAACTTATTGGGCACG R: aaacCGTGCCCAATAAGTTCCATC This paper N/A ESRP1 (c.665_683 del) repair template: TATTGAGTCCTTTGAAGAATCTTGCAATATCTTGATCTGAAGACTGCCATGGTAAACCTCGTGCCCTGACTACGGTGTTATCATCGATAAGTTCCATCTTGCTGCTGTGGATGAAGCAAAACTTCAGGTTGCATGATAAA This paper N/A ESRP1 (c.665_683 del) repair PCR genotyping primers: F: CACAGGCAGCCATGTTTCTA R: TAGGCAGTTGTCTTGCAGGG This paper N/A Software and Algorithms RUM Grant et al. 2011 http://www.cbil.upenn.edu/RUM/ edgeR Robinson et al. 2010 https://bioconductor.org/packages/release/bioc/html/edgeR.html MAJIQ Vaquero-Garcia et al., 2016 http://majiq.biociphers.org/ STAR Dobin et al., 2013 https://github.com/alexdobin/STAR Other Open in a separate window KEY RESOURCES TABLE

    Techniques: Transduction, Recombinant, Isolation, Derivative Assay, Modification, Sequencing, CRISPR, Software